\

Annotations

Annotations with coordinates

For more extensive documentation about annotations see Advanced sequence handling.

Automated introduction from reading genbank files

We load a sample genbank file with plenty of features and grab the CDS features.

>>> from cogent.parse.genbank import RichGenbankParser
>>> parser = RichGenbankParser(open('data/ST_genome_part.gb'))
>>> for accession, seq in parser:
...     print accession
...
AE006468
>>> cds = seq.getAnnotationsMatching('CDS')
>>> print cds
[CDS "thrL" at [189:255]/10020, CDS "thrA" at ...

Creating directly on a sequence

>>> from cogent import DNA
>>> from cogent.core.annotation import Feature
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> print s1[10:15] # this will be exon 1
CCCCC
>>> print s1[30:40] # this will be exon 2
TTTTTAAAAA
>>> print s1[45:48] # this will be exon 3
CCC
>>> s2 = DNA.makeSequence("CGAAACGTTT", Name="seq2")
>>> s3 = DNA.makeSequence("CGAAACGTTT", Name="seq3")

Via

addAnnotation

>>> from cogent import DNA
>>> from cogent.core.annotation import Feature
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> exon1 = s1.addAnnotation(Feature, 'exon', 'A', [(10,15)])
>>> exon2 = s1.addAnnotation(Feature, 'exon', 'B', [(30,40)])

addFeature

>>> from cogent import DNA
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> exon3 = s1.addFeature('exon', 'C', [(45, 48)])

There are other annotation types.

Adding as a series or item-wise

>>> from cogent import DNA
>>> s2 = DNA.makeSequence("CGAAACGTTT", Name="seq2")
>>> cpgs_series = s2.addFeature('cpgsite', 'cpg', [(0,2), (5,7)])
>>> s3 = DNA.makeSequence("CGAAACGTTT", Name="seq3")
>>> cpg1 = s3.addFeature('cpgsite', 'cpg', [(0,2)])
>>> cpg2 = s3.addFeature('cpgsite', 'cpg', [(5,7)])

Taking the union of annotations

Construct a pseudo-feature (cds) that’s a union of other features (exon1, exon2, exon3).

>>> from cogent import DNA
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> exon1 = s1.addFeature('exon', 'A', [(10,15)])
>>> exon2 = s1.addFeature('exon', 'B', [(30,40)])
>>> exon3 = s1.addFeature('exon', 'C', [(45, 48)])
>>> cds = s1.getRegionCoveringAll([exon1, exon2, exon3])

Getting annotation coordinates

These are useful for doing custom things, e.g. you could construct intron features using the below.

>>> cds.getCoordinates()
[(10, 15), (30, 40), (45, 48)]

Annotations have shadows

A shadow is a span representing everything but the annotation.

>>> not_cds = cds.getShadow()
>>> not_cds
region "not exon" at [0:10, 15:30, 40:45, 48:49]/49

Compare to the coordinates of the original.

>>> cds
region "exon" at [10:15, 30:40, 45:48]/49

Adding to a sequence member of an alignment

The following annotation is directly applied onto the sequence and so is in ungapped sequence coordinates.

>>> from cogent import LoadSeqs
>>> aln1 = LoadSeqs(data=[['x','-AAACCCCCA'],
...                       ['y','TTTT--TTTT']])
>>> seq_exon = aln1.getSeq('x').addFeature('exon', 'A', [(3,8)])

Adding to an alignment

We add an annotation directly onto an alignment. In this example we add a Variable that can be displayed as a red line on a drawing. The resulting annotation (red_data here) is in alignment coordinates!

>>> from cogent.core.annotation import Variable
>>> red_data = aln1.addAnnotation(Variable, 'redline', 'align',
...              [((0,15),1),((15,30),2),((30,45),3)])
...

Slicing sequences and alignments by annotations

By a feature or coordinates returns same sequence span

>>> from cogent import DNA
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> exon1 = s1.addFeature('exon', 'A', [(10,15)])
>>> exon2 = s1.addFeature('exon', 'B', [(30,40)])
>>> s1[exon1]
DnaSequence(CCCCC)
>>> s1[10:15]
DnaSequence(CCCCC)

Using the annotation object getSlice method returns the same thing.

>>> s1[exon2]
DnaSequence(TTTTTAAAAA)
>>> exon2.getSlice()
DnaSequence(TTTTTAAAAA)

Slicing by pseudo-feature or feature series

>>> from cogent import DNA
>>> s1 = DNA.makeSequence("AAGAAGAAGACCCCCAAAAAAAAAA"\
...                      "TTTTTTTTTTAAAAAGGGAACCCT",
...                      Name="seq1")
...
>>> exon1 = s1.addFeature('exon', 'A', [(10,15)])
>>> exon2 = s1.addFeature('exon', 'B', [(30,40)])
>>> exon3 = s1.addFeature('exon', 'C', [(45, 48)])
>>> cds = s1.getRegionCoveringAll([exon1, exon2, exon3])
>>> print s1[cds]
CCCCCTTTTTAAAAACCC
>>> print s1[exon1, exon2, exon3]
CCCCCTTTTTAAAAACCC

Warning

Slices are applied in order!

>>> print s1
AAGAAGAAGACCCCCAAAAAAAAAATTTTTTTTTTAAAAAGGGAACCCT
>>> print s1[exon1, exon2, exon3]
CCCCCTTTTTAAAAACCC
>>> print s1[exon2]
TTTTTAAAAA
>>> print s1[exon3]
CCC
>>> print s1[exon1, exon3, exon2]
CCCCCCCCTTTTTAAAAA

Slice series must not be overlapping

>>> s1[1:10, 9:15]
Traceback (most recent call last):
ValueError: Uninvertable. Overlap: 9 < 10
>>> s1[exon1, exon1]
Traceback (most recent call last):
ValueError: Uninvertable. Overlap: 10 < 15

But getRegionCoveringAll resolves this, ensuring no overlaps.

>>> print s1.getRegionCoveringAll([exon3, exon3]).getSlice()
CCC

You can slice an annotation itself

>>> print s1[exon2]
TTTTTAAAAA
>>> ex2_start = exon2[0:3]
>>> print s1[ex2_start]
TTT
>>> ex2_end = exon2[-3:]
>>> print s1[ex2_end]
AAA

Sequence vs Alignment slicing

You can’t slice an alignment using an annotation from a sequence.

>>> aln1[seq_exon]
Traceback (most recent call last):
ValueError: Can't map exon "A" at [3:8]/9 onto 2 x 10 text alignment: x[-AAACCCCCA], y[TTTT--TTTT] via []

Copying annotations

You can copy annotations onto sequences with the same name, even if the length differs

>>> aln2 = LoadSeqs(data=[['x', '-AAAAAAAAA'], ['y', 'TTTT--TTTT']])
>>> seq = DNA.makeSequence('CCCCCCCCCCCCCCCCCCCC', 'x')
>>> match_exon = seq.addFeature('exon', 'A', [(3,8)])
>>> aln2.getSeq('x').copyAnnotations(seq)
>>> copied = list(aln2.getAnnotationsFromSequence('x', 'exon'))
>>> copied
[exon "A" at [4:9]/10]

but if the feature lies outside the sequence being copied to, you get a lost span

>>> aln2 = LoadSeqs(data=[['x', '-AAAA'], ['y', 'TTTTT']])
>>> seq = DNA.makeSequence('CCCCCCCCCCCCCCCCCCCC', 'x')
>>> match_exon = seq.addFeature('exon', 'A', [(5,8)])
>>> aln2.getSeq('x').copyAnnotations(seq)
>>> copied = list(aln2.getAnnotationsFromSequence('x', 'exon'))
>>> copied
[exon "A" at [5:5, -4-]/5]
>>> copied[0].getSlice()
2 x 4 text alignment: x[----], y[----]

You can copy to a sequence with a different name, in a different alignment if the feature lies within the length

>>> # new test
>>> aln2 = LoadSeqs(data=[['x', '-AAAAAAAAA'], ['y', 'TTTT--TTTT']])
>>> seq = DNA.makeSequence('CCCCCCCCCCCCCCCCCCCC', 'x')
>>> match_exon = seq.addFeature('exon', 'A', [(5,8)])
>>> aln2.getSeq('y').copyAnnotations(seq)
>>> copied = list(aln2.getAnnotationsFromSequence('y', 'exon'))
>>> copied
[exon "A" at [7:10]/10]

If the sequence is shorter, again you get a lost span.

>>> aln2 = LoadSeqs(data=[['x', '-AAAAAAAAA'], ['y', 'TTTT--TTTT']])
>>> diff_len_seq = DNA.makeSequence('CCCCCCCCCCCCCCCCCCCCCCCCCCCC', 'x')
>>> nonmatch = diff_len_seq.addFeature('repeat', 'A', [(12,14)])
>>> aln2.getSeq('y').copyAnnotations(diff_len_seq)
>>> copied = list(aln2.getAnnotationsFromSequence('y', 'repeat'))
>>> copied
[repeat "A" at [10:10, -6-]/10]

Querying

You need to get a corresponding annotation projected into alignment coordinates via a query.

>>> aln_exon = aln1.getAnnotationsFromAnySequence('exon')
>>> print aln1[aln_exon]
>x
CCCCC
>y
--TTT

Querying produces objects only valid for their source

>>> cpgsite2 = s2.getAnnotationsMatching('cpgsite')
>>> print s2[cpgsite2]
CGCG
>>> cpgsite3 = s3.getAnnotationsMatching('cpgsite')
>>> s2[cpgsite3]
Traceback (most recent call last):
ValueError: Can't map cpgsite "cpg" at [0:2]/10 onto DnaSequence(CGAAACGTTT) via []

Querying for absent annotation

You get back an empty list, and slicing with this returns an empty sequence.

>>> # this test is new
>>> dont_exist = s2.getAnnotationsMatching('dont_exist')
>>> dont_exist
[]
>>> s2[dont_exist]
DnaSequence()

Querying features that span gaps in alignments

If you query for a feature from a sequence, it’s alignment coordinates may be discontinuous.

>>> aln3 = LoadSeqs(data=[['x', 'C-CCCAAAAA'], ['y', '-T----TTTT']])
>>> exon = aln3.getSeq('x').addFeature('exon', 'ex1', [(0,4)])
>>> print exon.getSlice()
CCCC
>>> aln_exons = list(aln3.getAnnotationsFromSequence('x', 'exon'))
>>> print aln_exons
[exon "ex1" at [0:1, 2:5]/10]
>>> print aln3[aln_exons]
>x
CCCC
>y
----

Note

The T opposite the gap is missing since this approach only returns positions directly corresponding to the feature.

asOneSpan unifies features with discontinuous alignment coordinates

To get positions spanned by a feature, including gaps, use asOneSpan.

>>> unified = aln_exons[0].asOneSpan()
>>> print aln3[unified]
>x
C-CCC
>y
-T---

Behaviour of annotations on nucleic acid sequences

Reverse complementing a sequence does not reverse annotations, that is they retain the reference to the frame for which they were defined.

>>> plus = DNA.makeSequence("CCCCCAAAAAAAAAATTTTTTTTTTAAAGG")
>>> plus_rpt = plus.addFeature('blah', 'a', [(5,15), (25, 28)])
>>> print plus[plus_rpt]
AAAAAAAAAAAAA
>>> minus = plus.rc()
>>> print minus
CCTTTAAAAAAAAAATTTTTTTTTTGGGGG
>>> minus_rpt = minus.getAnnotationsMatching('blah')
>>> print minus[minus_rpt]
AAAAAAAAAAAAA

Masking annotated regions

We mask the CDS regions.

>>> from cogent.parse.genbank import RichGenbankParser
>>> parser = RichGenbankParser(open('data/ST_genome_part.gb'))
>>> seq = [seq for accession, seq in parser][0]
>>> no_cds = seq.withMaskedAnnotations('CDS')
>>> print no_cds[150:400]
CAAGACAGACAAATAAAAATGACAGAGTACACAACATCC?????????...

The above sequence could then have positions filtered so no position with the ambiguous character ‘?’ was present.

Masking annotated regions on alignments

We mask exon’s on an alignment.

>>> from cogent import LoadSeqs, DNA
>>> aln = LoadSeqs(data=[['x', 'C-CCCAAAAAGGGAA'],
...                       ['y', '-T----TTTTG-GTT']], moltype=DNA)
>>> exon = aln.getSeq('x').addFeature('exon', 'norwegian', [(0,4)])
>>> print aln.withMaskedAnnotations('exon', mask_char='?')
>x
?-???AAAAAGGGAA
>y
-T----TTTTG-GTT

These also persist through reverse complement operations.

>>> rc = aln.rc()
>>> print rc
>x
TTCCCTTTTTGGG-G
>y
AAC-CAAAA----A-

>>> print rc.withMaskedAnnotations('exon', mask_char='?')
>x
TTCCCTTTTT???-?
>y
AAC-CAAAA----A-

You can take mask of the shadow

>>> from cogent import DNA
>>> s = DNA.makeSequence('CCCCAAAAAGGGAA', 'x')
>>> exon = s.addFeature('exon', 'norwegian', [(0,4)])
>>> rpt = s.addFeature('repeat', 'norwegian', [(9, 12)])
>>> rc = s.rc()
>>> print s.withMaskedAnnotations('exon', shadow=True)
CCCC??????????
>>> print rc.withMaskedAnnotations('exon', shadow=True)
??????????GGGG
>>> print s.withMaskedAnnotations(['exon', 'repeat'], shadow=True)
CCCC?????GGG??
>>> print rc.withMaskedAnnotations(['exon', 'repeat'], shadow=True)
??CCC?????GGGG

What features of a certain type are available?

>>> from cogent import DNA
>>> s = DNA.makeSequence('ATGACCCTGTAAAAAATGTGTTAACCC',
...    Name='a')
>>> cds1 = s.addFeature('cds','cds1', [(0,12)])
>>> cds2 = s.addFeature('cds','cds2', [(15,24)])
>>> all_cds = s.getAnnotationsMatching('cds')
>>> all_cds
[cds "cds1" at [0:12]/27, cds "cds2" at [15:24]/27]

Getting all features of a type, or everything but that type

The annotation methods getRegionCoveringAll and getShadow can be used to grab all the coding sequences or non-coding sequences in a DnaSequence object.

>>> from cogent.parse.genbank import RichGenbankParser
>>> parser = RichGenbankParser(open('data/ST_genome_part.gb'))
>>> seq = [seq for accession, seq in parser][0]
>>> all_cds = seq.getAnnotationsMatching('CDS')
>>> coding_seqs = seq.getRegionCoveringAll(all_cds)
>>> coding_seqs
region "CDS" at [189:255, 336:2799, 2800:3730, 3733...
>>> coding_seqs.getSlice()
DnaSequence(ATGAACC... 9063)
>>> noncoding_seqs = coding_seqs.getShadow()
>>> noncoding_seqs
region "not CDS" at [0:189, 255:336, 2799:2800, ...
>>> noncoding_seqs.getSlice()
DnaSequence(AGAGATT... 957)

Getting sequence features when you have an alignment object

Sequence features can be accessed via a containing Alignment.

>>> from cogent import LoadSeqs
>>> aln = LoadSeqs(data=[['x','-AAAAAAAAA'], ['y','TTTT--TTTT']])
>>> print aln
>x
-AAAAAAAAA
>y
TTTT--TTTT

>>> exon = aln.getSeq('x').addFeature('exon', '1', [(3,8)])
>>> aln_exons = aln.getAnnotationsFromSequence('x', 'exon')
>>> aln_exons = aln.getAnnotationsFromAnySequence('exon')
>>> aln_exons
[exon "1" at [4:9]/10]

Annotation display on sequences

We can display annotations on sequences, writing to file.

Note

This requires matplotlib be installed.

We first make a sequence and add some annotations.

>>> from cogent import DNA
>>> seq = DNA.makeSequence('aaaccggttt' * 10)
>>> v = seq.addFeature('exon', 'exon', [(20,35)])
>>> v = seq.addFeature('repeat_unit', 'repeat_unit', [(39,49)])
>>> v = seq.addFeature('repeat_unit', 'rep2', [(49,60)])

We then make a Display instance and write to file. This will use standard feature policy for colouring and shape of feature types.

>>> from cogent.draw.linear import Display
>>> seq_display = Display(seq, colour_sequences=True)
>>> fig = seq_display.makeFigure()
>>> fig.savefig('annotated_1.png')

Annotation display on alignments

>>> from cogent import DNA, LoadSeqs
>>> from cogent.core.annotation import Variable
>>> from cogent.draw.linear import Display
>>> aln = LoadSeqs('data/primate_cdx2_promoter.fasta', moltype=DNA)[:150]
>>> annot = aln.addAnnotation(Variable, 'redline', 'align',
...                          [((0,15),1),((15,30),2),((30,45),3)])
>>> annot = aln.addAnnotation(Variable, 'blueline', 'align',
...                          [((0,15),1.5),((15,30),2.5),((30,45),3.5)])
>>> align_display = Display(aln, colour_sequences=True)
>>> fig = align_display.makeFigure(width=25, left=1, right=1)
>>> fig.savefig('annotated_2.png')

Annotation display of a custom variable

We just show a series of spans.

>>> from cogent import DNA
>>> from cogent.draw.linear import Display
>>> from cogent.core.annotation import Variable
>>> seq = DNA.makeSequence('aaaccggttt' * 10)
>>> annot = seq.addAnnotation(Variable, 'redline', 'align',
...     [((0,15),1),((15,30),2),((30,45),3)])
...
>>> seq_display = Display(seq, colour_sequences=True)
>>> fig = seq_display.makeFigure()
>>> fig.savefig('annotated_3.png')

Generic metadata

To be written.

Info object

To be written.